pEB018
(Plasmid
#215568)
-
PurposeFuses insert of interest to an HA-tag, stop codon and S. commune Hom2 terminator, with flanks directing the construct to S. commune targeted integration locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPV033
-
Backbone manufacturerDr. Peter Jan Vonk
- Backbone size w/o insert (bp) 7568
- Total vector size (bp) 8362
-
Vector typeFungal homologous recombination plasmid
-
Selectable markersNourseothricin, Phleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3 x Hemagglutinin (HA) Tag / Stop codon / Intron / Hom2-terminator
-
SpeciesSynthetic; Schizophyllum commune
-
Insert Size (bp)794
-
GenBank IDXM_003029710
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CAGAAAAAACATGTGAGGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use BcuI (SpeI) site to integrate your construct of interest (e.g. promoter + gene) upstream of the HA-tag for integration of the construct at the targeted integration locus in S. commune. Use this approach to complement a gene knockout, combined with the possibility to subsequently perform pull-down experiments like Western Blotting or ChIP-Seq.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEB018 was a gift from Robin Ohm (Addgene plasmid # 215568 ; http://n2t.net/addgene:215568 ; RRID:Addgene_215568)