pCMV-ARMS1-ProLink2-MRGPRX3
(Plasmid
#213962)
-
PurposeExpresses MRGPRX3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-ARMS1-ProLinkTM 2
-
Backbone manufacturerEurofins DiscoverX, Fremont, CA, USA
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418), Hygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMRGPRX3
-
Entrez GeneMRGPRX3 (a.k.a. GPCR, MRGX3, SNSR1, SNSR2)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GCATAATGCTAGCACCATGGATTCAACCATCCCAGTCTTG
- 3′ sequencing primer TTCGAAGCTTGACTGCTCCAATCTGCTTCCCGAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChrista Müller research group
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-ARMS1-ProLink2-MRGPRX3 was a gift from Christa Müller (Addgene plasmid # 213962 ; http://n2t.net/addgene:213962 ; RRID:Addgene_213962) -
For your References section:
Proinflammatory chemokine CXCL14 activates MAS-related G protein-coupled receptor MRGPRX2 and its putative mouse ortholog MRGPRB2. Al Hamwi G, Namasivayam V, Buschbell B, Gedschold R, Golz S, Muller CE. Commun Biol. 2024 Jan 6;7(1):52. doi: 10.1038/s42003-023-05739-5. 10.1038/s42003-023-05739-5 PubMed 38184723