pRSF-G1TMSNKRS
(Plasmid
#198323)
-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSF
- Backbone size w/o insert (bp) 2452
- Total vector size (bp) 3274
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametRNA synthetase
-
Alt nameG1TMSNKRS
-
SpeciesMethanogenic archaeon ISO4-G1
-
Insert Size (bp)822
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF-G1TMSNKRS was a gift from Thomas Huber (Addgene plasmid # 198323 ; http://n2t.net/addgene:198323 ; RRID:Addgene_198323) -
For your References section:
Probing Ligand Binding Sites on Large Proteins by Nuclear Magnetic Resonance Spectroscopy of Genetically Encoded Non-Canonical Amino Acids. Ekanayake KB, Mahawaththa MC, Qianzhu H, Abdelkader EH, George J, Ullrich S, Murphy RB, Fry SE, Johansen-Leete J, Payne RJ, Nitsche C, Huber T, Otting G. J Med Chem. 2023 Mar 15. doi: 10.1021/acs.jmedchem.3c00222. 10.1021/acs.jmedchem.3c00222 PubMed 36920850