pUltra-MDH1-ME1
(Plasmid
#184465)
-
PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUltra
-
Backbone manufacturerobtained from Addgene (#24129)
- Backbone size w/o insert (bp) 8326
- Total vector size (bp) 11021
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMalate dehydrogenase 1
-
Alt nameMDH1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1002
-
Mutationdeletion of stop codon
-
GenBank IDNM_005917
- Promoter UbC
-
Tag
/ Fusion Protein
- fused to T2A
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggatctggagcaacaaacttc
- 3′ sequencing primer tagctgggccgggattttc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMalic Enzyme 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1719
-
GenBank IDNM_002395
-
Entrez GeneME1 (a.k.a. HUMNDME, MES)
- Promoter UbC
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gagggcaggggaagtctac
- 3′ sequencing primer gtatccacatagcgtaaaagg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence for the ME1 was from Addgene Plasmid #49163
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUltra-MDH1-ME1 was a gift from Gerardo Ferbeyre (Addgene plasmid # 184465 ; http://n2t.net/addgene:184465 ; RRID:Addgene_184465) -
For your References section:
A hydride transfer complex reprograms NAD metabolism and bypasses senescence. Igelmann S, Lessard F, Uchenunu O, Bouchard J, Fernandez-Ruiz A, Rowell MC, Lopes-Paciencia S, Papadopoli D, Fouillen A, Ponce KJ, Huot G, Mignacca L, Benfdil M, Kalegari P, Wahba HM, Pencik J, Vuong N, Quenneville J, Guillon J, Bourdeau V, Hulea L, Gagnon E, Kenner L, Moriggl R, Nanci A, Pollak MN, Omichinski JG, Topisirovic I, Ferbeyre G. Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028. 10.1016/j.molcel.2021.08.028 PubMed 34547241