pNTI661 pRPR1(TetO)-sgRNA
(Plasmid
#139475)
-
PurposeVector for tet-regulated sgRNA expression in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS41n
- Backbone size w/o insert (bp) 4898
- Total vector size (bp) 5171
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesingle guide RNA scaffold
-
Alt namesgRNA
-
SpeciesSynthetic; S pyogenes
-
Insert Size (bp)82
- Promoter pRPR1(TetO)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagcaacgcggcctttttacggttcctggcc
- 3′ sequencing primer CAGGAAAGACCGCGGcttaaagtcatacattgcacgacta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddGene #73796
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI661 pRPR1(TetO)-sgRNA was a gift from Nicholas Ingolia (Addgene plasmid # 139475 ; http://n2t.net/addgene:139475 ; RRID:Addgene_139475) -
For your References section:
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeast. McGlincy NJ, Meacham ZA, Reynaud KK, Muller R, Baum R, Ingolia NT. BMC Genomics. 2021 Mar 23;22(1):205. doi: 10.1186/s12864-021-07518-0. 10.1186/s12864-021-07518-0 PubMed 33757429