pUltra-FPheKRS
(Plasmid
#136631)
-
PurposeGenetic Incorporation 4-fluorophenyl carbamate lysine (FPheK) into proteins
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUltra
- Backbone size w/o insert (bp) 4037
- Total vector size (bp) 5297
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFPheKRS
-
SpeciesMethanosarcina barkeri
-
Insert Size (bp)1260
- Promoter Tac1 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer ATGGATAAAAAACCATTAGA
- 3′ sequencing primer TTATAGATTGGTTGAAATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUltra-FPheKRS was a gift from Han Xiao (Addgene plasmid # 136631 ; http://n2t.net/addgene:136631 ; RRID:Addgene_136631) -
For your References section:
Proximity-Induced Site-Specific Antibody Conjugation. Yu C, Tang J, Loredo A, Chen Y, Jung SY, Jain A, Gordon A, Xiao H. Bioconjug Chem. 2018 Nov 21;29(11):3522-3526. doi: 10.1021/acs.bioconjchem.8b00680. Epub 2018 Nov 1. 10.1021/acs.bioconjchem.8b00680 PubMed 30372039