-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size (bp) 5604
-
Modifications to backboneCA promoter, 4 mutated lox (FLEX) and multi cloning sites HindIII, EcoRV, AccI, HincII and SalI were added
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer XpAAVE-F (GCTAACCATGTTCATGCCTTC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CA-FLEX was a gift from Naoshige Uchida (Addgene plasmid # 38042 ; http://n2t.net/addgene:38042 ; RRID:Addgene_38042) -
For your References section:
Whole-brain mapping of direct inputs to midbrain dopamine neurons. Watabe-Uchida M, Zhu L, Ogawa SK, Vamanrao A, Uchida N. Neuron. 2012 Jun 7;74(5):858-73. 10.1016/j.neuron.2012.03.017 PubMed 22681690