-
Purpose(Empty Backbone) SGC Empty backbone for bacterial expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-28-a
-
Backbone manufacturerNovagen
- Backbone size (bp) 5330
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor plasmid propagation and cloning use any E. coli strain not expressing T7 RNA polymerase. For expression, use a strain that expresses T7 RNA polymerase, e.g. BL21(DE3).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
GenBank IDEF199844
-
Tag
/ Fusion Protein
- TEV - His6 - Flag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ligation-Independent cloning; cut with BfuAI (destroyed during cloning)
- 3′ cloning site Ligation-Independent cloning; cut with BfuAI (destroyed during cloning)
- 5′ sequencing primer T7F
- 3′ sequencing primer T7R (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for LIC cloning:
Upstream: add TTAAGAAGGAGATATACTATG to the 5’ end (ATG in-frame with the desired coding
sequence).
Downstream: add GATTGGAAGTAGAGGTTCTCTGC to 5’ end of downstream primer (no termination codon!)
Detailed cloning method available in the paper (Savitsky et al., J Struct Biol., 2010)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNIC-CTHF was a gift from Opher Gileadi (Addgene plasmid # 26105 ; http://n2t.net/addgene:26105 ; RRID:Addgene_26105) -
For your References section:
High-throughput production of human proteins for crystallization: The SGC experience. Savitsky P, Bray J, Cooper CD, Marsden BD, Mahajan P, Burgess-Brown NA, Gileadi O. J Struct Biol. 2010 Jun 10. ():. 10.1016/j.jsb.2010.06.008 PubMed 20541610