pC1.530
(Plasmid #205441)

• Purpose: Level 1 Position 1 pUC19 vector with sgRNA and GmR. Used for homologous recombination with Cas12a editing vector pC1.509. sgRNA targets pC1.509 for removal.
• Depositing Lab: Alistair McCormick
• Publication: Victoria et al Plant Physiol. 2024 May 7:kiae261. doi: 10.1093/plphys/kiae261.

Backbone

• Vector backbone: n/a
• Total vector size (bp): 6420
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RepB gRNA
• gRNA/shRNA sequence: ttaataaatatagtttaagtaa
• Species: Synthetic

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: n/a

Resource Information

• Supplemental Documents:
  • pC1.530 Curing vector (Cas12a sgRNA).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

11901 toolkit compatible with CyanoGate Kit

Please note: The GmR cassette has a 19 bp deletion near the beginning of the CDS but is still functional.