pC1.530
(Plasmid
#205441)
-
PurposeLevel 1 Position 1 pUC19 vector with sgRNA and GmR. Used for homologous recombination with Cas12a editing vector pC1.509. sgRNA targets pC1.509 for removal.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonen/a
- Total vector size (bp) 6420
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRepB gRNA
-
gRNA/shRNA sequencettaataaatatagtttaagtaa
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
11901 toolkit compatible with CyanoGate Kit
Please note: The GmR cassette has a 19 bp deletion near the beginning of the CDS but is still functional.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1.530 was a gift from Alistair McCormick (Addgene plasmid # 205441 ; http://n2t.net/addgene:205441 ; RRID:Addgene_205441) -
For your References section:
A toolbox to engineer the highly productive cyanobacterium Synechococcus sp. PCC 11901. Victoria AJ, Selao TT, Moreno-Cabezuelo JA, Mills LA, Gale GAR, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2024 May 7:kiae261. doi: 10.1093/plphys/kiae261. 10.1093/plphys/kiae261 PubMed 38713768