ACE2 g1 + Cas9
(Plasmid
#153011)
-
PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Lentiviral Prep | 153011-LV | Virus (1mL at titer ≥ 5x10⁵ TU/mL) and Plasmid. | $180 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti-Cas9-gRNA-TagBFP2 (Addgene #124774)
-
Vector typeLentiviral, CRISPR
-
Selectable markersTagBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 + ACE2 gRNA
-
Alt nameACE2
-
gRNA/shRNA sequenceACCTGGGGAAGGGCGACTTC
-
SpeciesH. sapiens (human)
-
Entrez GeneACE2 (a.k.a. ACEH)
-
Tag
/ Fusion Protein
- TagBFP2
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Lentiviral Prep (Catalog # 153011-LV) ( Back to top)
Purpose
Ready-to-use Lentiviral Prep particles produced from ACE2 g1 + Cas9 (#153011). In addition to the viral particles, you will also receive purified ACE2 g1 + Cas9 plasmid DNA.
Lentiviral particles carrying a guide RNA targeting ACE2 and co-expressing Cas9 and TagBFP2.Delivery
- Volume 1mL
- Titer ≥5x10⁵ TU/mL
- Pricing $150 USD for preparation of 1mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 153011-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCRs were carried out on the viral preparation with primers targeting the Cas9 and TagBFP genes to confirm inserts and primers targeting the EF1a promoter and the ACE2 guide to confirm the backbone and guide sequences. The PCR products were visualized on an agarose gel for size confirmation.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACE2 g1 + Cas9 was a gift from Jason Sheltzer (Addgene plasmid # 153011 ; http://n2t.net/addgene:153011 ; RRID:Addgene_153011) For viral preps, please replace (Addgene plasmid # 153011) in the above sentence with: (Addgene viral prep # 153011-LV)