-
PurposeBroad-host plasmid expressing gfp under pLtetO promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSF
-
Backbone manufacturerSergey V Mashko
- Backbone size w/o insert (bp) 8728
- Total vector size (bp) 9664
-
Modifications to backboneinserted pLtetO-gfpmut3b
-
Selectable markersCarbanicillin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepLtetO-GFPmut3b
-
Insert Size (bp)717
- Promoter pLtetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATCAAATTAAGCAGAAGGCCATCCTGA
- 3′ sequencing primer GCTTCCCGTTTCAGCTGCGTTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2016/06/12/058487 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF-pLtetO-gfp was a gift from George Church (Addgene plasmid # 89476 ; http://n2t.net/addgene:89476 ; RRID:Addgene_89476) -
For your References section:
Functional genomics of the rapidly replicating bacterium Vibrio natriegens by CRISPRi. Lee HH, Ostrov N, Wong BG, Gold MA, Khalil AS, Church GM. Nat Microbiol. 2019 Apr 8. pii: 10.1038/s41564-019-0423-8. doi: 10.1038/s41564-019-0423-8. 10.1038/s41564-019-0423-8 PubMed 30962569