Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mTiam1-mcherry-sspB in pcDNA3.1
(Plasmid #85221)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85221 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 8295
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mTiam1 (1030-1406)
  • Alt name
    Tiam1
  • Species
    M. musculus (mouse)
  • GenBank ID
    NP_033410
  • Entrez Gene
    Tiam1 (a.k.a. D16Ium10, D16Ium10e)
  • Promoter CMV
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer T7 primer
  • 3′ sequencing primer BGH reverse primer
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mcherry
  • Species
    Synthetic
  • Insert Size (bp)
    710
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (destroyed during cloning)
  • 3′ cloning site BspE1 (not destroyed)
  • 5′ sequencing primer cgggttttccacctctgctgc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    sspB
  • Species
    bacterial
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspE1 (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ggactacaccatcgtggaacagtacgaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mTiam1-mcherry-sspB in pcDNA3.1 was a gift from Narasimhan Gautam (Addgene plasmid # 85221 ; http://n2t.net/addgene:85221 ; RRID:Addgene_85221)
  • For your References section:

    Subcellular optogenetic activation of Cdc42 controls local and distal signaling to drive immune cell migration. O'Neill PR, Kalyanaraman V, Gautam N. Mol Biol Cell. 2016 May 1;27(9):1442-50. doi: 10.1091/mbc.E15-12-0832. Epub 2016 Mar 3. 10.1091/mbc.E15-12-0832 PubMed 26941336