Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-SWAP70
(Plasmid #84581)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84581 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SWAP70
  • Alt name
    SWP70, KIAA0640, HSPC321
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1774
  • GenBank ID
    NM_001297714.1
  • Entrez Gene
    SWAP70 (a.k.a. HSPC321, SWAP-70)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCCGCCGGGATCAC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-SWAP70 was a gift from Geert van den Bogaart (Addgene plasmid # 84581 ; http://n2t.net/addgene:84581 ; RRID:Addgene_84581)
  • For your References section:

    SWAP70 Organizes the Actin Cytoskeleton and Is Essential for Phagocytosis. Baranov MV, Revelo NH, Dingjan I, Maraspini R, Ter Beest M, Honigmann A, van den Bogaart G. Cell Rep. 2016 Nov 1;17(6):1518-1531. doi: 10.1016/j.celrep.2016.10.021. 10.1016/j.celrep.2016.10.021 PubMed 27806292