Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

piRFP-N3-Tyrosinase
(Plasmid #80152)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80152 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    piRFP682
  • Backbone size w/o insert (bp) 4904
  • Total vector size (bp) 6546
  • Modifications to backbone
    EGFP in pEGFP-N3 was replaced by iRFP682 to generate piRFP682-N3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tyrosinase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1642
  • GenBank ID
    NM_000372
  • Entrez Gene
    TYR (a.k.a. ATN, CMM8, OCA1, OCA1A, OCAIA, SHEP3)
  • Promoter CMV
  • Tag / Fusion Protein
    • iRFP682 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    piRFP-N3-Tyrosinase was a gift from Santiago Di Pietro (Addgene plasmid # 80152 ; http://n2t.net/addgene:80152 ; RRID:Addgene_80152)
  • For your References section:

    TPC2 controls pigmentation by regulating melanosome pH and size. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2. 10.1073/pnas.1600108113 PubMed 27140606