Mucolipin1-pHcRed C1
(Plasmid
#62959)
-
Purposefull length human Mucolipin-1 cloned into pHcRed1 C1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHcRed1 C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMucolipin-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1830
-
MutationMucolipin-1 has 1 silent mutation compared to the coding sequence of NM_020533.2 N328 AAT instead of AAC
-
GenBank IDNM_020533.2 Q9GZU1
-
Entrez GeneMCOLN1 (a.k.a. LECD, MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HcRed1 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer 5’ CACCGACATCCGGCTCCAGATG 3’
- 3′ sequencing primer 5’ GGACAAACCACAACTAGAATGCAGTG 3’ (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mucolipin1-pHcRed C1 was a gift from Paul Luzio (Addgene plasmid # 62959 ; http://n2t.net/addgene:62959 ; RRID:Addgene_62959) -
For your References section:
Mucolipin-1 is a lysosomal membrane protein required for intracellular lactosylceramide traffic. Pryor PR, Reimann F, Gribble FM, Luzio JP. Traffic. 2006 Oct;7(10):1388-98. 10.1111/j.1600-0854.2006.00475.x PubMed 16978393