Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRK-FLAG-UbxD8
(Plasmid #53777)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53777 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 4353
  • Total vector size (bp) 5700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    UbxD8
  • Alt name
    FAF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1350
  • GenBank ID
    NP_055428
  • Entrez Gene
    FAF2 (a.k.a. ETEA, UBXD8, UBXN3B)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACGCGTCGACC atgaccgaaatgagcttcctgagc
  • 3′ sequencing primer ATAGTTTAGCGGCCGC ctaggggacccttttcttccc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Origene
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK-FLAG-UbxD8 was a gift from Yihong Ye (Addgene plasmid # 53777 ; http://n2t.net/addgene:53777 ; RRID:Addgene_53777)
  • For your References section:

    A ubiquitin-like domain recruits an oligomeric chaperone to a retrotranslocation complex in endoplasmic reticulum-associated degradation. Xu Y, Liu Y, Lee JG, Ye Y. J Biol Chem. 2013 Jun 21;288(25):18068-76. doi: 10.1074/jbc.M112.449199. Epub 2013 May 12. 10.1074/jbc.M112.449199 PubMed 23665563