Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

psiCheck-ApoECDS
(Plasmid #41848)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41848 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PsiCheck2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6400
  • Modifications to backbone
    The CDS of ApoE is chimerically fused to the C terminus of the renilla luciferase reporter in the psiCheck2 vector by removing the luciferase stop codon and inserting a 6 amino acid-long linker connecting the CDS of luciferase to the CDS of ApoE.
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ApoE CDS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    954
  • GenBank ID
    NM_000041
  • Entrez Gene
    APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
  • Tag / Fusion Protein
    • renilla luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTACATCAAGAGCTTCGTGG
  • 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck-ApoECDS was a gift from Sohail Tavazoie (Addgene plasmid # 41848 ; http://n2t.net/addgene:41848 ; RRID:Addgene_41848)
  • For your References section:

    Convergent Multi-miRNA Targeting of ApoE Drives LRP1/LRP8-Dependent Melanoma Metastasis and Angiogenesis. Pencheva N, Tran H, Buss C, Huh D, Drobnjak M, Busam K, Tavazoie SF. Cell. 2012 Nov 21;151(5):1068-82. doi: 10.1016/j.cell.2012.10.028. Epub 2012 Nov 8. 10.1016/j.cell.2012.10.028 PubMed 23142051