Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMXs-IP-EGFP-ULK1(1-828)
(Plasmid #38198)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 38198 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5847
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    a novel protein kinase structurally related to C. elegans UNC-51
  • Alt name
    ULK1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2484
  • Mutation
    deleted amino acids 829-1051
  • GenBank ID
    AF053756
  • Entrez Gene
    Ulk1 (a.k.a. AU041434, Unc51.1, mKIAA0722)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
  • 3′ sequencing primer GAGGAACTGCTTCCTTCACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IP-EGFP-ULK1(1-828) was a gift from Noboru Mizushima (Addgene plasmid # 38198 ; http://n2t.net/addgene:38198 ; RRID:Addgene_38198)
  • For your References section:

    FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N. J Cell Biol. 2008 May 5. 181(3):497-510. 10.1083/jcb.200712064 PubMed 18443221