pD2sE_SC14
(Plasmid #219717)

• Purpose: DV2 stable E dimer
• Depositing Lab: Brian Kuhlman
• Publication: Kudlacek et al Sci Adv. 2021 Oct 15;7(42):eabg4084. doi: 10.1126/sciadv.abg4084. Epub 2021 Oct 15.

Backbone

• Vector backbone: PalphaH
• Backbone manufacturer: modified from pHLSec
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DV2 sE SC14
• Species: Dengue virus
• Insert Size (bp): 1278
• Mutation: A259W, T262R, F279W, T280P
• Tags / Fusion Proteins:
  • human serum albumin (HSA) (N terminal on insert)
  • 8xHis (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: GTGCTGTCTCATCATTTTGGCAAA
• 3′ sequencing primer: ACACCAGCCACCACCTTCT

Resource Information

• Supplemental Documents:
  • pD2sE_SC14.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry