Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSiP4
(Plasmid #21960)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21960 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    psiCHECK2
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pten
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    850
  • Entrez Gene
    Pten (a.k.a. 2310035O07Rik, A130070J02Rik, B430203M17Rik, MMAC1, PTENbeta, TEP1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTCCGCAACTACAACGCCTACCTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSiP4 was a gift from Klaus Rajewsky (Addgene plasmid # 21960 ; http://n2t.net/addgene:21960 ; RRID:Addgene_21960)
  • For your References section:

    Lymphoproliferative disease and autoimmunity in mice with increased miR-17-92 expression in lymphocytes. Xiao C, Srinivasan L, Calado DP, Patterson HC, Zhang B, Wang J, Henderson JM, Kutok JL, Rajewsky K. Nat Immunol. 2008 Apr . 9(4):405-14. 10.1038/ni1575 PubMed 18327259