2C-EGFP-t2a-mCD4
(Plasmid #216213)

• Purpose: Expresses GFP and mCD4 transmembrane domain under control of the 2C-specific MERVL promoter
• Depositing Lab: Michelle Percharde
• Publication: Xie et al Genes Dev. 2022 Mar 1;36(5-6):331-347. doi: 10.1101/gad.349172.121. Epub 2022 Mar 10.

Backbone

• Vector backbone: pEGFP-N2
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CD4
• Species: M. musculus (mouse)
• Insert Size (bp): 2061
• Mutation: CD4 transmembrane domain only
• Entrez Gene: Cd4 (a.k.a. L3T4, Ly-4)
• Promoter: MERVL
• Tag / Fusion Protein:
  • GFP-T2A (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: caaagaccccaacgagaagc
• 3′ sequencing primer: agatacattgatgagtttggacaaacc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry