Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TRE-mClover3-TDP-43ΔNLS
(Plasmid #214917)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 214917 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lab generated
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TDP-43ΔNLS
  • Species
    H. sapiens (human)
  • Mutation
    mutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGTGGCAGTGGCAGCAGCA
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Tag / Fusion Protein
    • mClover3 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRE-mClover3-TDP-43ΔNLS was a gift from Ophir Shalem (Addgene plasmid # 214917 ; http://n2t.net/addgene:214917 ; RRID:Addgene_214917)
  • For your References section:

    CRISPR screen for protein inclusion formation uncovers a role for SRRD in the regulation of intermediate filament dynamics and aggresome assembly. Sweeney KM, Chantarawong S, Barbieri EM, Cajka G, Liu M, Spruce L, Fazelinia H, Portz B, Copley K, Lapidot T, Duhamel L, Greenwald P, Saida N, Shalgi R, Shorter J, Shalem O. PLoS Genet. 2024 Feb 5;20(2):e1011138. doi: 10.1371/journal.pgen.1011138. eCollection 2024 Feb. 10.1371/journal.pgen.1011138 PubMed 38315730