pAcBac1-Ma-sfGFP 150TAG
(Plasmid
#197568)
-
PurposeExpression of sfGFP-150TAG with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAcBac1
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 9795
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesfGFP 150TAG
-
Insert Size (bp)723
-
MutationN150TAG
- Promoter CMV
-
Tag
/ Fusion Protein
- V5-His6 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameM. alvus Pyl-tRNA (6) (4x copies)
-
SpeciesMethanomethylophilus alvus
-
Insert Size (bp)69
- Promoter U6/H1
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer gtagccgaagatgacggtttgtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid should be paired with another pAcBac1 vector that expresses both a M. alvus PylRS variant/M. alvus Pyl-tRNA pair
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcBac1-Ma-sfGFP 150TAG was a gift from Ryan Mehl (Addgene plasmid # 197568 ; http://n2t.net/addgene:197568 ; RRID:Addgene_197568) -
For your References section:
Generating Efficient Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetases for Structurally Diverse Non-Canonical Amino Acids. Avila-Crump S, Hemshorn ML, Jones CM, Mbengi L, Meyer K, Griffis JA, Jana S, Petrina GE, Pagar VV, Karplus PA, Petersson EJ, Perona JJ, Mehl RA, Cooley RB. ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16. 10.1021/acschembio.2c00639 PubMed 36383641